GPI14/YJR013W Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2004-11-02.
Standard Name Reference
GPI14 Kinoshita T and Inoue N  (2000) Dissecting and manipulating the pathway for glycosylphos-phatidylinositol-anchor biosynthesis. Curr Opin Chem Biol 4(6):632-8
Other Name(s)Reference
PMH1 Keranen, S  (2003) personal communication
Nomenclature History Notes
DateNote
2004-11-02The name PMH1 was reserved for YJR013W from 2003-12-03 to 2004-11-02 but was not published.
Sequence Annotation Notes
DateNote
2004-02-12Brachat et al. predicted and confirmed the deletion of a single T nt. As a consequence of this sequence change, YJR013W was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 305 to 403 amino acids. This change was also predicted by Cliften et al. and Kellis et al..
New: 460173 GTACACTGATATCGACTATTTT-GTGTTTCATGATGCTGCTAAATATGTATACGAAGGCA 460231 
            |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| 
Old: 460173 GTACACTGATATCGACTATTTTTGTGTTTCATGATGCTGCTAAATATGTATACGAAGGCA 460232 
Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Brachat S, et al.  (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6