BUD19/YJL188C Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2001-08-13.
Standard Name Reference
BUD19 Ni L and Snyder M  (2001) A genomic study of the bipolar bud site selection pattern in Saccharomyces cerevisiae. Mol Biol Cell 12(7):2147-70
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution within the coding region of BUD19/YJL188C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 90 is now Cysteine rather than Tyrosine. This nucleotide change is also present in the intron of the overlapping ORF, RPL39/YJL189W, but does not change the protein coding sequence of RPL39/YJL189W.
New    76201   TTTATGTCAGGTGGTATTGCCTTGGATCCGTGAATGCATCACATTGATGAGTTTGAACAT  76260
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old    76200   TTTATGTCAGGTGGTATTGCCTTGGATCCGTGAATGCATCATATTGATGAGTTTGAACAT  76259
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()