ATG27/YJL178C Locus History Help


Nomenclature History
Standard Name Reference
ATG27 Klionsky DJ, et al.  (2003) A unified nomenclature for yeast autophagy-related genes. Dev Cell 5(4):539-45
Other Name(s)Reference
ETF1 Wurmser AE and Emr SD  (2002) Novel PtdIns(3)P-binding protein Etf1 functions as an effector of the Vps34 PtdIns 3-kinase in autophagy. J Cell Biol 158(4):761-72
Nomenclature History Notes
DateNote
2003-09-10The standard gene name of ORF YJL178C was changed from ETF1 to ATG27, as part of the unified autophagy nomenclature agreed upon by the yeast research community.
Sequence Annotation Notes
DateNote
2004-02-12Brachat et al. predicted and confirmed the insertion of a single G nt. As a consequence of this sequence change, YJL178C was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 196 to 271 amino acids.
 
New: 89864 ATAGCATGTCATTTTTTTTACATTCTTCAGGAGGTTCTACGTTATGCTCTTCGCAAACGT 89923
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Old: 89864 ATAGCATGTCATTTTTTTTACATTCTTCAG-AGGTTCTACGTTATGCTCTTCGCAAACGT 89922 
Brachat S, et al.  (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
2011-02-03A single nucleotide substitution was made in the intergenic region between ORFs ATG27/YJL178C and RPL17B/YJL177W.
New    90351   GGCGTGGGAAGTGAAGCTCTTTCGCTCTTTCTGTGATGATCTCCTTCCAGCTAGGCTCGG  90410
               |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old    90349   GGCGTGGGAAGTGAAGATCTTTCGCTCTTTCTGTGATGATCTCCTTCCAGCTAGGCTCGG  90408
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()