ASG7/YJL170C Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2000-11-20.
Standard Name Reference
ASG7 Zhong H, et al.  (1999) Identification of target sites of the alpha2-Mcm1 repressor complex in the yeast genome. Genome Res 9(11):1040-7
Sequence Annotation Notes
DateNote
2003-12-01Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for ASG7/YJL170C be moved 77 nt upstream. This suggestion was reviewed by SGD curators, but will not be incorporated until supported by experimental data. The reason(s) for this decision are as follows: Change to the suggested stop codon would require a sequence change in S. cerevisiae. Addition of a single base 31 nts upstream of the current start site would produce a predicted protein sequence of the same length and with a high degree of sequence similarity to those from S. paradoxus, S. mikatae, and S. bayanus. Further sequencing of an S288C strain would be required to determine if any change should be made to the S. cerevisiae sequence.

Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2008-10-28RNA sequencing data from Nagalakshmi et al. 2008 suggest that there is an in-frame AUG 5 codons upstream of the currently annotated AUG for either all or some of the transcripts of ASG7/YJL170C.

Nagalakshmi U, et al.  (2008) The transcriptional landscape of the yeast genome defined by RNA sequencing. Science 320(5881):1344-9
2006-01-18SGD confirmed the sequence error suggested by Kellis et al and has updated the sequence accordingly. As a consequence of this change, ASG7/YJL170C has been extended on the 5' end, altering the N-terminus and increasing the size of the predicted protein from 183 to 209 amino acids. 
Insert a G after the G at 101726
New: 101713 TCTCGAAGGGCGCGGCTAGATGTTTTGTTTT 101743
            |||||||||||||| ||||||||||||||||
Old: 101713 TCTCGAAGGGCGCG-CTAGATGTTTTGTTTT 101742
Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54