TPK1/YJL164C Locus History Help


Nomenclature History
Standard Name Reference
TPK1 Cannon, J.F.  (1989) Personal Communication, Mortimer Map Edition 10
Other Name(s)Reference
SRA3 Cannon JF and Tatchell K  (1987) Characterization of Saccharomyces cerevisiae genes encoding subunits of cyclic AMP-dependent protein kinase. Mol Cell Biol 7(8):2653-63
Sequence Annotation Notes
DateNote
2011-02-03Nucleotide changes within the coding region of TPK1/YJL164C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 79-86 are now SGKYSLQD rather than VGSIVYKN.
New    110877  TACCCAGTGTCCTTAATATCTGAAAGT-CTTGTAAACTATACTTCCCACTTGTAACTCTC  110935
               ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||
Old    110871  TACCCAGTGTCCTTAATATCTGAAAGTTCTTGTAAACTATACTTCCCACT-GTAACTCTC  110929
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03Two separate single nucleotide deletions were made in the intergenic region between ORFs TPK1/YJL164C and YJL163C.
New    111246  AAGCCGATTGAAAATGCAAGCAAGCCAAACAAAAAAAAAAGTATAGGG-TCAGATTCCTT  111304
               |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    111240  AAGCCGATTGAAAATGCAAGCAAGCCAAACAAAAAAAAAAGTATAGGGGTCAGATTCCTT  111299
New    111605  TAGCAGCACAGCTTCGAACAAGTAACTAAAAATATGTGGTGTATAC-GGTATGTAAATGT  111663
               |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    111600  TAGCAGCACAGCTTCGAACAAGTAACTAAAAATATGTGGTGTATACCGGTATGTAAATGT  111659
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1989-10-01Edition 10: SRA3 is allelic to tpk1

Mortimer RK, et al.  (1989) Genetic map of Saccharomyces cerevisiae, edition 10. Yeast 5(5):321-403