HSP150/YJL159W Locus History Help


Nomenclature History
Standard Name Reference
HSP150 Russo P, et al.  (1992) A heat shock gene from Saccharomyces cerevisiae encoding a secretory glycoprotein. Proc Natl Acad Sci U S A 89(9):3671-5
Other Name(s)Reference
CCW7 Mrsa V, et al.  (1997) Specific labelling of cell wall proteins by biotinylation. Identification of four covalently linked O-mannosylated proteins of Saccharomyces cerevisiae. Yeast 13(12):1145-54
ORE1 Yun DJ, et al.  (1997) Stress proteins on the yeast cell surface determine resistance to osmotin, a plant antifungal protein. Proc Natl Acad Sci U S A 94(13):7082-7
PIR2 Toh-e A, et al.  (1993) Three yeast genes, PIR1, PIR2 and PIR3, containing internal tandem repeats, are related to each other, and PIR1 and PIR2 are required for tolerance to heat shock. Yeast 9(5):481-94
Sequence Annotation Notes
DateNote
2004-02-18Both Brachat et al. 2003 and Moukadiri and Zueco 2001 independently predicted and confirmed a 220-bp insertion within HSP150/YJL159W. As a consequence of this sequence change, HSP150/YJL159W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 310 to 387 amino acids.
New: 121225 CAAGTAAGCGATGGCCAAGTCCAAGCTACTACTGCTACTTCCGCTTCTGCAGCCGCTACC 121284
            ||||||||||||||||||||||||||||||||||
Old: 121225 CAAGTAAGCGATGGCCAAGTCCAAGCTACTACTG-------------------------- 121258

New: 121285 TCCACTGACCCAGTCGATGCTGTCTCCTGTAAGACTTCTGGTACCTTAGAAATGAACTTA 121344
Old:        ------------------------------------------------------------

New: 121345 AAGGGCGGTATCTTAACTGACGGTAAGGGTAGAATTGGTTCTATTGTTGCTAACAGACAA 121404
Old:        ------------------------------------------------------------

New: 121405 TTCCAATTTGACGGTCCACCACCACAAGCTGGTGCCATCTACGCTGCTGGTTGGTCTATA 121464
Old:        ------------------------------------------------------------

New: 121465 ACTCCAGACGGTAACTTGGCTATTGGTGACAATGATGTCTTCTACCAATGTTTGTCCGGT 121524
                          |||||||||||||||||||||||||||||||||||||||||||||| 
Old: 121259 --------------CTTGGCTATTGGTGACAATGATGTCTTCTACCAATGTTTGTCCGGT 121304 
Moukadiri I and Zueco J  (2001) YJL159w does encode Pir2/Hsp150. Yeast 18(4):323-4
Brachat S, et al.  (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
2006-10-04Moukadiri and Zueco 2001 predicted, but did not confirm, two additional sequence insertions in HSP150/YJL159W. These two insertions (6 nts and 72 nts) were later confirmed in S288C by Marinangeli et al. 2004, and have been incorporated in SGD. Special thanks to Ivo Pedruzzi and the team at Swiss-Prot for bringing this change to our attention.
new 120745 TCTCAGATCGGTGATGGTCAAATCCAAGCTACTACTAAGACTACCGCTGCTGCTGTCTCT 120804
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
old 120745 TCTCAGATCGGTGATGGTCAAATCCAAGCTACTACTAAGACTACCGCTGCTGCTGTCTCT 120804

new 120805 CAAATTGGTGATGGTCAAATTCAAGCTACCACCAAGACTACCTCTGCTAAGACTACCGCC 120864
           |      |||||||||||||||||||||||||||||||||||||||||||||||||||||
old 120805 C------GTGATGGTCAAATTCAAGCTACCACCAAGACTACCTCTGCTAAGACTACCGCC 120858

new 120865 GCTGCCGTTTCTCAAATCAGTGATGGTCAAATCCAAGCTACCACCACTACTTTAGCCCCA 120924
           |||||||||||||||||||||||||||||||||||||||||||||||||||
old 120859 GCTGCCGTTTCTCAAATCAGTGATGGTCAAATCCAAGCTACCACCACTACT--------- 120909

new 120924 AAGAGCACCGCTGCTGCCGTTTCTCAAATCGGTGATGGTCAAGTTCAAGCTACCACCACT 120984

old        ------------------------------------------------------------ 

new 120985 ACTTTAGCCCCAAAGAGCACCGCTGCTGCCGTTTCTCAAATCGGTGATGGTCAAGTTCAA 121044
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
old 120910 ---TTAGCCCCAAAGAGCACCGCTGCTGCCGTTTCTCAAATCGGTGATGGTCAAGTTCAA 120966
Moukadiri I and Zueco J  (2001) YJL159w does encode Pir2/Hsp150. Yeast 18(4):323-4
Marinangeli P, et al.  (2004) Minisatellites in Saccharomyces cerevisiae genes encoding cell wall proteins: a new way towards wine strain characterisation. FEMS Yeast Res 4(4-5):427-35
Mapping Notes
DateNote
1997-10-20Edition 14: HSP150 has also been called gp400

Cherry JM, et al.  (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73