ASF1/YJL115W Locus History Help


Nomenclature History
Standard Name Reference
ASF1 Sternglanz, R.  (1993) Personal Communication, Mortimer Map Edition 12
Other Name(s)Reference
CIA1 Yamaki M, et al.  (2001) Cell death with predominant apoptotic features in Saccharomyces cerevisiae mediated by deletion of the histone chaperone ASF1/CIA1. Genes Cells 6(12):1043-54
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs NCA3/YJL116C and ASF1/YJL115W.
New    195472  GTCACGTGCGGGTCTAGGCCTGCATAATCGGCCCTCACAGAGGGATCCCGTTACCCATCT  195531
               ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old    195470  GTCACGTGCGGGTCTAGGCCTGCATAATCGGCC-TCACAGAGGGATCCCGTTACCCATCT  195528
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1994-08-01Edition 12: asf1 is about 20 kb proximal to pbs2

Mortimer RK, et al.  (1994) "Genetic and Physical maps of Saccharomyces cerevisiae (Edition 12)". Pp. 374-377 in 1994 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America