MDV1/YJL112W Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2000-10-18.
Standard Name Reference
MDV1 Tieu Q and Nunnari J  (2000) Mdv1p is a WD repeat protein that interacts with the dynamin-related GTPase, Dnm1p, to trigger mitochondrial division. J Cell Biol 151(2):353-66
Other Name(s)Reference
FIS2 Mozdy AD, et al.  (2000) Dnm1p GTPase-mediated mitochondrial fission is a multi-step process requiring the novel integral membrane component Fis1p. J Cell Biol 151(2):367-80
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made within ORF MDV1/YJL112W. Note that the protein sequence was not affected.
New    205310  AGTGAACGACCAAATAACTCATATAGGAAAAACATTGTCCACAACGGCTTCCGCTTTTTT  205369
               |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    205305  AGTGAACGACCAAATAACTCATATAGGAAAAACATTGTCCACCACGGCTTCCGCTTTTTT  205364
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()