MRPL49/YJL096W Locus History Help


Nomenclature History
Standard Name Reference
MRPL49 Kitakawa M, et al.  (1997) Identification and characterization of the genes for mitochondrial ribosomal proteins of Saccharomyces cerevisiae. Eur J Biochem 245(2):449-56
Other Name(s)Reference
YmL49 Kitakawa M, et al.  (1997) Identification and characterization of the genes for mitochondrial ribosomal proteins of Saccharomyces cerevisiae. Eur J Biochem 245(2):449-56
Sequence Annotation Notes
DateNote
2003-09-22Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for MRPL49/YJL096W be moved 189 nt (63 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Graack et al (1998) identify MRPL49/YJL096W as 16kDa protein, a size consistent with the proposed change.

Graack HR and Wittmann-Liebold B  (1998) Mitochondrial ribosomal proteins (MRPs) of yeast. Biochem J 329 ( Pt 3)():433-48
Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs MRPL49/YJL096W and BCK1/YJL095W.
New    247010  AAATCATGTAAATAACAATAAAATTTGACACACTTTCTTCGGCCCCAATGGCCATTCAAT  247069
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old    247005  AAATCATGTAAATAACAATAAAATTTGACACACTTTCTTCG-CCCCAATGGCCATTCAAT  247063
Dietrich F  (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. ()