BBC1/YJL020C Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2002-01-02.
Standard Name Reference
BBC1 Tong AH, et al.  (2002) A combined experimental and computational strategy to define protein interaction networks for peptide recognition modules. Science 295(5553):321-4
Other Name(s)Reference
MTI1 Mochida J, et al.  (2002) The novel adaptor protein, Mti1p, and Vrp1p, a homolog of Wiskott-Aldrich syndrome protein-interacting protein (WIP), may antagonistically regulate type I myosins in Saccharomyces cerevisiae. Genetics 160(3):923-34
Sequence Annotation Notes
DateNote
2001-06-27Sequence update from MIPS introduces two Gs after position 399914, then two more Gs after position 399923 on chromosome 10. Due to these 4 G insertions, the earlier ORFs YJL020C and YJL021C are now merged into one long ORF YJL020C of 1157 amino acids.

Old: 399901 CTGGAGGTACTGGG--TACTGGG--TACTGAAGGTGCAGAGAGTGCTGGAGGTGCTGGAG 399956
            ||||||||||||||  |||||||  |||||||||||||||||||||||||||||||||||
New: 399901 CTGGAGGTACTGGGGGTACTGGGGGTACTGAAGGTGCAGAGAGTGCTGGAGGTGCTGGAG 399960

References:

  1. Personal communication - Dr. Charlie Boone, University of Toronto, Canada
  2. Sequence update notification from MIPS to SGD, dated June 27, 2001
Brachat S, et al.  (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45