MPS3/YJL019W Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2002-12-23.
Standard Name Reference
MPS3 Jaspersen SL, et al.  (2002) Mps3p is a novel component of the yeast spindle pole body that interacts with the yeast centrin homologue Cdc31p. J Cell Biol 159(6):945-56
Other Name(s)Reference
NEP98 Nishikawa S, et al.  (2003) Nep98p is a component of the yeast spindle pole body and essential for nuclear division and fusion. J Biol Chem 278(11):9938-43
Sequence Annotation Notes
DateNote
2003-01-02Due to the insertion of a single G nucleotide after the G at 404443 on chromosome 10, YJL018W and YJL019W have been merged into one single ORF - MPS3/YJL019W. Note that YJL018W and NEP98 are now aliases for this merged ORF. We thank Sue L. Jasperson and Mark Winey for reporting this sequence error to SGD.

Old: 404401 CATATCTCTGAGGAAATTTATCATCAACGGAGTGACACCGCAG-ATTTGCAAATAATTGA 404459
            ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
New: 404401 CATATCTCTGAGGAAATTTATCATCAACGGAGTGACACCGCAGGATTTGCAAATAATTGA 404460
Jaspersen SL, et al.  (2002) Mps3p is a novel component of the yeast spindle pole body that interacts with the yeast centrin homologue Cdc31p. J Cell Biol 159(6):945-56
Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Brachat S, et al.  (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45