VTC4/YJL012C Locus History 
- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Expression
- Protein
- Wiki
| Nomenclature History | |
|---|---|
| An SGD Standard Name was first assigned to this gene on 2000-09-18. | |
| Standard Name | Reference |
| VTC4 | Cohen A, et al. (1999) A novel family of yeast chaperons involved in the distribution of V-ATPase and other membrane proteins. J Biol Chem 274(38):26885-93 |
| Other Name(s) | Reference |
|---|---|
| PHM3 | Ogawa N, et al. (2000) New components of a system for phosphate accumulation and polyphosphate metabolism in Saccharomyces cerevisiae revealed by genomic expression analysis. Mol Biol Cell 11(12):4309-21 |
| Nomenclature History Notes | |
|---|---|
| Date | Note |
| 2000-09-18 | The ORF YJL012C was published as VTC4 (1999: Nelson, N.), and has been implicated in phosphate metabolism (2000: Ogawa, N). |
| Sequence Annotation Notes | |
|---|---|
| Date | Note |
| 2004-02-17 | Heinz Neumann and coworkers predicted and confirmed a single nt insertion in VTC4/YJL012C (Genbank accession number AY264259). As a consequence of this sequence change, VTC4/YJL012C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 648 to 721 amino acids. As a consequence of this change, YJL012C-A was merged with VTC4/YJL012C.
New: 411230 TTTTGGTTCCACACGAACTGGCACACATATCGTCTTTCCCGGTGGGGCACGAATTTGAGT 411289
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old: 411230 TTTTGGTTCCACACGAACTGGCACACATATCGTCTTTCC-GGTGGGGCACGAATTTGAGT 411288 |
| Muller O, et al. (2003) Role of the Vtc proteins in V-ATPase stability and membrane trafficking. J Cell Sci 116(Pt 6):1107-15 | |
