VTC4/YJL012C Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2000-09-18.
Standard Name Reference
VTC4 Cohen A, et al.  (1999) A novel family of yeast chaperons involved in the distribution of V-ATPase and other membrane proteins. J Biol Chem 274(38):26885-93
Other Name(s)Reference
PHM3 Ogawa N, et al.  (2000) New components of a system for phosphate accumulation and polyphosphate metabolism in Saccharomyces cerevisiae revealed by genomic expression analysis. Mol Biol Cell 11(12):4309-21
Nomenclature History Notes
DateNote
2000-09-18The ORF YJL012C was published as VTC4 (1999: Nelson, N.), and has been implicated in phosphate metabolism (2000: Ogawa, N).
Sequence Annotation Notes
DateNote
2004-02-17Heinz Neumann and coworkers predicted and confirmed a single nt insertion in VTC4/YJL012C (Genbank accession number AY264259). As a consequence of this sequence change, VTC4/YJL012C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 648 to 721 amino acids. As a consequence of this change, YJL012C-A was merged with VTC4/YJL012C.
New: 411230 TTTTGGTTCCACACGAACTGGCACACATATCGTCTTTCCCGGTGGGGCACGAATTTGAGT 411289
            ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old: 411230 TTTTGGTTCCACACGAACTGGCACACATATCGTCTTTCC-GGTGGGGCACGAATTTGAGT 411288 
Muller O, et al.  (2003) Role of the Vtc proteins in V-ATPase stability and membrane trafficking. J Cell Sci 116(Pt 6):1107-15