CCT8/YJL008C Locus History Help


Nomenclature History
Standard Name Reference
CCT8 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made within ORF CCT8/YJL008C. Note that the protein sequence was not affected.
New    421490  ATGGTTAACAATGATCTTGTTTCTACCACAGGGTCCCATAGAAGTCAAACACATTTGATG  421549
               ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Old    421483  ATGGTTAACAATGATCTTGTTTCTACCGCAGGGTCCCATAGAAGTCAAACACATTTGATG  421542
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1996-09-21Edition 13: CCT8 was previously refered to as TCP8. A new standard nomenclature for the chaperonin subunits was adopted for yeast, human and mouse in 1995.

Cherry JM, et al.  (1996) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 13)". Pp. 361-364 in 1996 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America