YHB1/YGR234W Locus History Help


Nomenclature History
Standard Name Reference
YHB1 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion was made in the intergenic region between ORFs PHO81/YGR233C and YHB1/YGR234W.
New    958890   GCAAGAATAATAGGGCACGGTACGTTCATT-CACGTAGCGTTAGCTAGTGCTGCCACAAG  958948
                |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Old    958893   GCAAGAATAATAGGGCACGGTACGTTCATTCCACGTAGCGTTAGCTAGTGCTGCCACAAG  958952
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()