DIE2/YGR227W Locus History Help


Nomenclature History
Standard Name Reference
DIE2 Nikawa J and Hosaka K  (1995) Isolation and characterization of genes that promote the expression of inositol transporter gene ITR1 in Saccharomyces cerevisiae. Mol Microbiol 16(2):301-8
Other Name(s)Reference
ALG10 Burda P and Aebi M  (1998) The ALG10 locus of Saccharomyces cerevisiae encodes the alpha-1,2 glucosyltransferase of the endoplasmic reticulum: the terminal glucose of the lipid-linked oligosaccharide is required for efficient N-linked glycosylation. Glycobiology 8(5):455-62
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution within the coding region of DIE2/YGR227W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 266 is now Isoleucine rather than Lysine.
New    948200   GTTCTGCCCTATATGATAAATTTTGTTTTGTTCTTCATTTATCTGATTTGGAACAGATCC  948259
                |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old    948203   GTTCTGCCCTATATGAAAAATTTTGTTTTGTTCTTCATTTATCTGATTTGGAACAGATCC  948262
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()