RPS23A/YGR118W Locus History 
- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Expression
- Protein
- Wiki
| Nomenclature History | |
|---|---|
| Standard Name | Reference |
| RPS23A | SGD (2007) Information without a citation in SGD () |
| Other Name(s) | Reference |
|---|---|
| rp37 | Planta RJ and Mager WH (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7 |
| S12 | Jenner L, et al. (2012) Crystal structure of the 80S yeast ribosome. Curr Opin Struct Biol 22(6):759-67 |
| S23A | Planta RJ and Mager WH (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7 |
| S28A | Planta RJ and Mager WH (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7 |
| YS14 | Planta RJ and Mager WH (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7 |
| Sequence Annotation Notes | |
|---|---|
| Date | Note |
| 2011-02-03 | A single nucleotide deletion was made within the intron of ORF RPS23A/YGR118W.
New 727112 TTGTGAGCTCTGGAGTGATAAATTTATC-AGTAACATATCCTGGCGCAAATCAGTTTGGA 727170
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Old 727116 TTGTGAGCTCTGGAGTGATAAATTTATCAAGTAACATATCCTGGCGCAAATCAGTTTGGA 727175 |
| Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. () | |
| Mapping Notes | |
|---|---|
| Date | Note |
| 1997-10-20 | Edition 14: RPS23A was previously called RPS28A, but should not be confused with YOR167C encoding ribosomal protein S28A |
| Cherry JM, et al. (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73 | |
