RPS23A/YGR118W Locus History Help


Nomenclature History
Standard Name Reference
RPS23A SGD  (2007) Information without a citation in SGD ()
Other Name(s)Reference
rp37 Planta RJ and Mager WH  (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7
S12 Jenner L, et al.  (2012) Crystal structure of the 80S yeast ribosome. Curr Opin Struct Biol 22(6):759-67
S23A Planta RJ and Mager WH  (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7
S28A Planta RJ and Mager WH  (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7
YS14 Planta RJ and Mager WH  (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion was made within the intron of ORF RPS23A/YGR118W.
New    727112   TTGTGAGCTCTGGAGTGATAAATTTATC-AGTAACATATCCTGGCGCAAATCAGTTTGGA  727170
                |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Old    727116   TTGTGAGCTCTGGAGTGATAAATTTATCAAGTAACATATCCTGGCGCAAATCAGTTTGGA  727175
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1997-10-20Edition 14: RPS23A was previously called RPS28A, but should not be confused with YOR167C encoding ribosomal protein S28A

Cherry JM, et al.  (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73