DAM1/YGR113W Locus History Help


Nomenclature History
Standard Name Reference
DAM1 Hofmann C, et al.  (1998) Saccharomyces cerevisiae Duo1p and Dam1p, novel proteins involved in mitotic spindle function. J Cell Biol 143(4):1029-40
Sequence Annotation Notes
DateNote
2000-06-16Iain Cheeseman reported that a single frameshift 874 bp into the open reading frame at chromosomal coordinate 719761 (TATAC to TATCAC) results in a different coding sequence for the last 44 amino acids and a different stop codon 24 bp downstream from the sequence originally stored in SGD. The Candida DAM1 homolog is more similar to the sequence that Iain Cheeseman reports. SGD incorporated this sequence change on 2001-05-31.

Old: 719701 TACCCATCGAAAACGACAATGTTGTTAATTTGGGAGATCTGCATCCAAATAATCGAATAT 719760
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New: 719701 TACCCATCGAAAACGACAATGTTGTTAATTTGGGAGATCTGCATCCAAATAATCGAATAT 719760
Old: 719761 -ACTCGGAAGTGGTGCTGCAAGAGTGGTCAATGGGCCCGTTACGAAGAACAGAAATTCAA 719819
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New: 719761 CACTCGGAAGTGGTGCTGCAAGAGTGGTCAATGGGCCCGTTACGAAGAACAGAAATTCAA 719820