VID30/YGL227W Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2001-10-04.
Standard Name Reference
VID30 McCann, J., et al.  (2000) A novel membrane-associated protein Vid30p regulates import of fructose-1,6-bisphosphatase into Vid vesicles
Other Name(s)Reference
GID1 Hammerle M, et al.  (1998) Proteins of newly isolated mutants and the amino-terminal proline are essential for ubiquitin-proteasome-catalyzed catabolite degradation of fructose-1,6-bisphosphatase of Saccharomyces cerevisiae. J Biol Chem 273(39):25000-5 Regelmann J, et al.  (2003) Catabolite degradation of fructose-1,6-bisphosphatase in the yeast Saccharomyces cerevisiae: a genome-wide screen identifies eight novel GID genes and indicates the existence of two degradation pathways. Mol Biol Cell 14(4):1652-63
Nomenclature History Notes
DateNote
2000-05-19The name TIN1 was originally reserved for this ORF. The name has been changed to VID30.
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs VID30/YGL227W and OST5/YGL226C-A.
New    72671    AATATTCTCATCCAAAATACTTCTTAAGTATAGTATATAATTTCATCGATAATTCCTTTA  72730
                |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    72671    AATATTCTCATCCAAAATACTTCTTAAGTATAGTATATAATT-CATCGATAATTCCTTTA  72729
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()