- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Expression
- Protein
- Wiki
| Nomenclature History | |
|---|---|
| An SGD Standard Name was first assigned to this gene on 2001-10-04. | |
| Standard Name | Reference |
| VID30 | Eugster, A.C. and T. Beck (1997) In preparation McCann, J., et al. (2000) A novel membrane-associated protein Vid30p regulates import of fructose-1,6-bisphosphatase into Vid vesicles |
| Other Name(s) | Reference |
|---|---|
| GID1 | Hammerle M, et al. (1998) Proteins of newly isolated mutants and the amino-terminal proline are essential for ubiquitin-proteasome-catalyzed catabolite degradation of fructose-1,6-bisphosphatase of Saccharomyces cerevisiae. J Biol Chem 273(39):25000-5 Regelmann J, et al. (2003) Catabolite degradation of fructose-1,6-bisphosphatase in the yeast Saccharomyces cerevisiae: a genome-wide screen identifies eight novel GID genes and indicates the existence of two degradation pathways. Mol Biol Cell 14(4):1652-63 |
| Nomenclature History Notes | |
|---|---|
| Date | Note |
| 2000-05-19 | The name TIN1 was originally reserved for this ORF. The name has been changed to VID30. |
| Sequence Annotation Notes | |
|---|---|
| Date | Note |
| 2011-02-03 | A single nucleotide insertion was made in the intergenic region between ORFs VID30/YGL227W and OST5/YGL226C-A.
New 72671 AATATTCTCATCCAAAATACTTCTTAAGTATAGTATATAATTTCATCGATAATTCCTTTA 72730
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old 72671 AATATTCTCATCCAAAATACTTCTTAAGTATAGTATATAATT-CATCGATAATTCCTTTA 72729 |
| Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. () | |



