MIG2/YGL209W Locus History Help


Nomenclature History
Standard Name Reference
MIG2 Lutfiyya LL and Johnston M  (1996) Two zinc-finger-containing repressors are responsible for glucose repression of SUC2 expression. Mol Cell Biol 16(9):4790-7
Other Name(s)Reference
MLZ1 Kail M, et al.  (1996) Lambda clone B22 contains a 7676 bp genomic fragment of Saccharomyces cerevisiae chromosome VII spanning the VAM7-SPM2 intergenic region and containing three novel transcribed open reading frames. Yeast 12(8):799-807
Sequence Annotation Notes
DateNote
2011-02-03Several nucleotide sequence changes were made in the intergenic region between ORFs YPT32/YGL210W and MIG2/YFL209W.
New    94553    ACATATACCTTCCCAAGTTATTTATTACTAACCTTCGTTGCACGCAAGAAAAAATGTATT  94612
                |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Old    94558    ACATATACCTTCCCAAGTTATTTATTACTAACCTTCGT-GCACGCAAGAAAAAATGTATT  94616
New    95033    ATTAGAGCGTGTTTCGGAAAACAAACTCGCTCGATACAGTAATTG-C-GTTTTATTTACG  95090
                ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||
Old    95037    ATTAGAGCGTGTTTCGGAAAACAAACTCGCTCGATACAGTAATTGGCAGTTTTATTTACG  95096
New    95391    CTTGCGTCAACTAGCTCTCCCCTTTCCCCATTGAAGTTAGCGTATTA-CCATCAGTTAAT  95449
                ||||||||||||||||||||||||||||||||||||||||||||||| ||  ||||||||
Old    95397    CTTGCGTCAACTAGCTCTCCCCTTTCCCCATTGAAGTTAGCGTATTAACCTACAGTTAAT  95456
New    95450    GATTGATAGGCTCATACGAAGAAGAAAAAAAGCCGGGATAAGAAACCCCGCCTCCACTTT  95509
                ||||||||||||||| |||||||||||||  |||||||||||||||||||||||||||||
Old    95457    GATTGATAGGCTCAT-CGAAGAAGAAAAA--GCCGGGATAAGAAACCCCGCCTCCACTTT  95513
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()