SIP2/YGL208W Locus History Help


Nomenclature History
Standard Name Reference
SIP2 Yang X, et al.  (1994) A family of proteins containing a conserved domain that mediates interaction with the yeast SNF1 protein kinase complex. EMBO J 13(24):5878-86
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made within ORF SIP2/YGL208W. Note that the protein sequence was not affected.
New    98150    TCGATCCTCAATTGCTCTACAAATTGGTAAGGATCCAGACGATTTTGGTGACGGATATAC  98209
                |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old    98154    TCGATCCTCAATTGCTCTGCAAATTGGTAAGGATCCAGACGATTTTGGTGACGGATATAC  98213
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()