MCM6/YGL201C Locus History Help


Nomenclature History
Standard Name Reference
MCM6 Tye BK  (1999) Minichromosome maintenance as a genetic assay for defects in DNA replication. Methods 18(3):329-34
Sequence Annotation Notes
DateNote
2004-01-23A single C nucleotide at chromosomal coordinate 120375 was changed to a G, altering the coding sequence of MCM6/YGL201C. The start, stop, and reading frame remain the same, but protein residue 179 is now a proline rather than an alanine. See GenBank Accession AY258324. Thanks to Andrea Duina and F. Winston for resequencing this region in S288c.
New: 120335 TACTTTCTTACTACTCTTCTTAAACCCTTTTGTAAAAAAGGCAAAAATCTGTAATATTGT 120394
            |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old: 120335 TACTTTCTTACTACTCTTCTTAAACCCTTTTGTAAAAAAGCCAAAAATCTGTAATATTGT 120394 
Mapping Notes
DateNote
1998-11-10Edition 15: MCM6 is homologous to the S. pombe Mis5. MCM6 is a member of the MCM/P1-family of genes which play a role in the licensing of DNA replication; others members of this family include : MCM2, MCM3, MCM4 (CDC54), MCM5 (CDC46), and MCM7 (CDC47).

Cherry JM, et al.  (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America