GCN1/YGL195W Locus History Help


Nomenclature History
Standard Name Reference
GCN1 Skvirsky RC, et al.  (1986) A new negative control gene for amino acid biosynthesis in Saccharomyces cerevisiae. Curr Genet 10(7):495-501
Other Name(s)Reference
AAS103 Thireos G, et al.  (1984) 5' untranslated sequences are required for the translational control of a yeast regulatory gene. Proc Natl Acad Sci U S A 81(16):5096-100
NDR1 Thireos G, et al.  (1984) 5' untranslated sequences are required for the translational control of a yeast regulatory gene. Proc Natl Acad Sci U S A 81(16):5096-100
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion was made in the intergenic region between ORFs DSD1/YGL196W and GCN1/YGL195W.
New    131208   TCTCTGTGTCTATGTAATTGTGTATCTATTTATAAATAGTAACTAAGAG-TAAGGTTGTA  131266
                ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    131213   TCTCTGTGTCTATGTAATTGTGTATCTATTTATAAATAGTAACTAAGAGGTAAGGTTGTA  131272
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()