CDC20/YGL116W Locus History Help


Nomenclature History
Standard Name Reference
CDC20 Hartwell LH, et al.  (1973) Genetic Control of the Cell Division Cycle in Yeast: V. Genetic Analysis of cdc Mutants. Genetics 74(2):267-286
Other Name(s)Reference
PAC5 Geiser JR, et al.  (1997) Saccharomyces cerevisiae genes required in the absence of the CIN8-encoded spindle motor act in functionally diverse mitotic pathways. Mol Biol Cell 8(6):1035-50
Sequence Annotation Notes
DateNote
2011-02-03Three separate single nucleotide insertions were made in the intergenic region between ORFs YGL117W and CDC20/YGL116W.
New    289484   CAATTTGATTGCCGAAAGAGGCAAAACGTAAATAGGGTTGGTTTCAAATAATTAGAAGGA  289543
                |||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||
Old    289490   CAATTTGATTGCCGAAAGAGGCAAAACGTAAATAGG-TT-GTTTCAAATAATTAGAAGGA  289547
New    289544   GCATCGGAAAAATGCAACGAGCAAAACCTCTAGCAGGCAAAGAATTTATCACCTTTAAAA  289603
                |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Old    289548   GCATCGGAAAAATGCAACGA-CAAAACCTCTAGCAGGCAAAGAATTTATCACCTTTAAAA  289606
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()