RIM8/YGL045W Locus History Help


Nomenclature History
Standard Name Reference
RIM8 Su SS and Mitchell AP  (1993) Identification of functionally related genes that stimulate early meiotic gene expression in yeast. Genetics 133(1):67-77
Other Name(s)Reference
ART9 Lin CH, et al.  (2008) Arrestin-related ubiquitin-ligase adaptors regulate endocytosis and protein turnover at the cell surface. Cell 135(4):714-25
PAL3 Treton B, et al.  (2000) Ambient pH signalling in ascomycetous yeasts involves homologues of the Aspergillus nidulans genes palF and paIH. Mol Gen Genet 263(3):505-13
Sequence Annotation Notes
DateNote
2003-01-09Due to the following changes to the systematic sequence of Chromosome VII, YGL045W and YGL046W have been merged into one single larger ORF: A insertion at 414883, C insertion at 414910, CC insertion at 414983, and G deletion at 415042. RIM8 is the standard name for the new merged ORF; YGL046W is now an alias of RIM8/YGL045W. We thank Claude Gaillardin and Aaron P. Mitchell for reporting this sequence error to SGD.

Old: 414838 TTCTAGCAGTTCAGTAAACTCCAAGACGTCCCCCTTACCAAATAAA-CGGTGACTATATC 414896
            |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New: 414841 TTCTAGCAGTTCAGTAAACTCCAAGACGTCCCCCTTACCAAATAAAACGGTGACTATATC 414900

Old: 414897 CGTAGACATAC-GCAGGCTGGATTCATGATTGGTGAAATTATCCCTATAGACGTTAAGAT 414955
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New: 414901 CGTAGACATACCGCAGGCTGGATTCATGATTGGTGAAATTATCCCTATAGACGTTAAGAT 414960

Old: 414956 TGACCACTATAAGCCTTTCTATGCC--TGCGGGTCTCACCACCACTTTGGTGAGGATATG 415013
            |||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||
New: 414961 TGACCACTATAAGCCTTTCTATGCCCCTGCGGGTCTCACCACCACTTTGGTGAGGATATG 415020

Old: 415014 TAGGGTGGGCGGTGCAGGCAAAGATGGATCCTATGGAGACTTTCAGAAAAGATATATGTC 415073
            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New: 415021 TAGGGTGGGCGGTGCAGGCAAAGATG-ATCCTATGGAGACTTTCAGAAAAGATATATGTC 415079
Treton B, et al.  (2000) Ambient pH signalling in ascomycetous yeasts involves homologues of the Aspergillus nidulans genes palF and paIH. Mol Gen Genet 263(3):505-13
Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2011-02-03Several nucleotide sequence changes were made in the intergenic region between Ty1 LTR YGLWdelta10 and ORF RIM8/YGL045W.
New    413077   TCTACAGCCG-ACGGGCACTCTATGTATACTCATATCACAGCCACTGTTGCACTACATTA  413135
                |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Old    413079   TCTACAGCCGGACGGGCACTCTATGTATACTCATATCACAGCCACTGTTGCACTACATTA  413138
New    413316   TCGCACGGGTCTTCTGTGCGAATGAGCCACAACGGGGCCGAGTTCAGCGCGTGTCCGCCT  413375
                |||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||
Old    413319   TCGCACGGGTCTTCTGTGCGAATGAGCCACAACGGGGCCGAGTTCAGGCCGTGTCCGCCT  413378
New    413376   ACAACGTCCGCCAACTAGTGGCAATTGCTAGGCTACGCCGACCACGCTGACACGCACCGT  413435
                |||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||
Old    413379   ACAACGTCCGCCAACTAGTGGCAATTGCTACG-TACGCCGACCACGCTGACACGCACCGT  413437
New    413736   CTTAATCGCCTTTCTTTGTTTTCTTTCTTCGTTATTTGTTCTTGGA-CTTTTCCGCTCCA  413794
                |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    413738   CTTAATCGCCTTTCTTTGTTTTCTTTCTTCGTTATTTGTTCTTGGAACTTTTCCGCTCCA  413797
New    413925   TGTCTAAGCTCTATTGAGTCAAAAGTAACAATCTAGACGAAG-AAAAAAAAAAAATAGAA  413983
                |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    413928   TGTCTAAGCTCTATTGAGTCAAAAGTAACAATCTAGACGAAGGAAAAAAAAAAAATAGAA  413987
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()