HSP31/YDR533C Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2004-02-15.
Standard Name Reference
HSP31 Wilson MA, et al.  (2004) The 1.8-A resolution crystal structure of YDR533Cp from Saccharomyces cerevisiae: A member of the DJ-1/ThiJ/PfpI superfamily. Proc Natl Acad Sci U S A 101(6):1531-6
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs HSP31/YDR533C and FIT1/YDR534C.
New    1502693  TTTCTTCTCTCTGACCTAAATTATTACAGCCATATATAACTTTTTTTTTTAAATTCGGAT  1502752
                |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old    1502686  TTTCTTCTCTCTGACCTAAATTATTACAGCCATATATAAC-TTTTTTTTTAAATTCGGAT  1502744
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()