ATP22/YDR350C Locus History 
- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Expression
- Protein
- Wiki
| Nomenclature History | |
|---|---|
| Standard Name | Reference |
| ATP22 | Helfenbein KG, et al. (2003) ATP22, a nuclear gene required for expression of the F0 sector of mitochondrial ATPase in Saccharomyces cerevisiae. J Biol Chem 278(22):19751-6 |
| Other Name(s) | Reference |
|---|---|
| TCM10 | Zhang Y, et al. (1997) Isolation and Characterization of a Saccharomyces Cerevisiae Gene, TCM10, Involved in Mitochondrial Biogenesis Protein Eng 10:6-8 |
| Nomenclature History Notes | |
|---|---|
| Date | Note |
| 2006-11-13 | By agreement among researchers who have studied YDR350C, the standard name was changed from TCM10 to ATP22. The new name reflects its role in the assembly of the F1-F0 ATP synthase. |
| Helfenbein KG, et al. (2003) ATP22, a nuclear gene required for expression of the F0 sector of mitochondrial ATPase in Saccharomyces cerevisiae. J Biol Chem 278(22):19751-6 | |
| Sequence Annotation Notes | |
|---|---|
| Date | Note |
| 2011-02-03 | A single nucleotide was inserted within ORF ATP22/YDR350C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 73 amino acids longer.
New 1176353 TGATTTCAAAGCCCCCGAAGAGTATCTTATTGTACCAGGAGCGTGCTCCTTTTTCGTCTC 1176412
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old 1176348 TGATTTCAAAGCCCCCGAAGAGTATCTTATTGTACCAGGAGCGTGCTC-TTTTTCGTCTC 1176406
|
| Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. () | |
