YCG1/YDR325W Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2000-04-24.
Standard Name Reference
YCG1 Ouspenski II, et al.  (2000) Chromosome condensation factor Brn1p is required for chromatid separation in mitosis. Mol Biol Cell 11(4):1305-13
Other Name(s)Reference
TIE1 Shiba Y, et al.  (1999) Isolation and characterization of the gene conferring thiamine-inducible expression from Saccharomyces cerevisiae. Biosci Biotechnol Biochem 63(8):1414-9
YCS5 Freeman L, et al.  (2000) The condensin complex governs chromosome condensation and mitotic transmission of rDNA. J Cell Biol 149(4):811-24
Sequence Annotation Notes
DateNote
2002-12-17Due to the deletion of G at 1117105, the start for YDR325W has been moved 48 nt downstream from 1117069 to 1117116. The stop has not been changed. Thanks to Denise Bertsch for reporting this sequence error to SGD.
Old: 1117081 TTGGATAAGACAAAGAAGTTAACAGCCGCGCCCATCATGCAAGATCCTGATGGTATTGAC 1117140
             |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
New: 1117081 TTGGATAAGACAAAGAAGTTAACA-CCGCGCCCATCATGCAAGATCCTGATGGTATTGAC 1117139
Lavoie BD, et al.  (2002) In vivo dissection of the chromosome condensation machinery: reversibility of condensation distinguishes contributions of condensin and cohesin. J Cell Biol 156(5):805-15
2011-02-03A dinucleotide insertion was made in the intergenic region between ORFs UTP4/YDR324C and YCG1/YDR325W.
New    1117073  AGTAATGCCTACAGCCTTGGATAAGACAAAGAAGTTAACAGGCCGCGCCCATCATGCAAG  1117132
                ||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||
Old    1117071  AGTAATGCCTACAGCCTTGGATAAGACAAAGAAGTTAACA--CCGCGCCCATCATGCAAG  1117128
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()