UTP4/YDR324C Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2002-06-14.
Standard Name Reference
UTP4 Dragon F, et al.  (2002) A large nucleolar U3 ribonucleoprotein required for 18S ribosomal RNA biogenesis. Nature 417(6892):967-70
Sequence Annotation Notes
DateNote
2011-02-03A dinucleotide insertion was made in the intergenic region between ORFs UTP4/YDR324C and YCG1/YDR325W.
New    1117073  AGTAATGCCTACAGCCTTGGATAAGACAAAGAAGTTAACAGGCCGCGCCCATCATGCAAG  1117132
                ||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||
Old    1117071  AGTAATGCCTACAGCCTTGGATAAGACAAAGAAGTTAACA--CCGCGCCCATCATGCAAG  1117128
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()