RRP8/YDR083W Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2000-09-21.
Standard Name Reference
RRP8 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2003-12-01Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the stop site for RRP8/YDR083W be moved 26 nt downstream. This suggestion was reviewed by SGD curators, but will not be incorporated until supported by experimental data. The reason(s) for this decision are as follows: data from Kellis et al. suggest a single nucleotide insertion that would cause a frameshift near the C-terminal end of the predicted protein, and change the C-terminal end of the protein from ...AEENGS to ...AEGKWLLKPCIYKRR. This proposed sequence change is consistent with previously published data by Bousquet-Antonelli et al, which show that the C-terminal domain (...CIYKRR ) is highly conserved motif that is found in not only in the Saccharomyces species studied by Kellis et al., but also in Schizosaccharomyces pombe, Arabidopsis Thaliana, Caenorhabditis elegans, Plasmodium falciparum, and mammals (Bousquet-Antonelli C, et al (2000) RNA6(6):826-43). However, it cannot be incorporated until the proposed S. cerevisiae sequencing error has been confirmed in S288C.

Bousquet-Antonelli C, et al.  (2000) Rrp8p is a yeast nucleolar protein functionally linked to Gar1p and involved in pre-rRNA cleavage at site A2. RNA 6(6):826-43
Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2008-10-24RNA sequencing data from Nagalakshmi et al. 2008 suggest that there is an in-frame AUG 19 codons upstream of the currently annotated AUG for either all or some of the transcripts of RRP8/YDR083W. The upstream AUG represents the previously annotated start for this ORF, the annotation of which was changed based on comparative DNA sequence data from Kellis et al. 2003 and Cliften et al. 2003.

Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
Nagalakshmi U, et al.  (2008) The transcriptional landscape of the yeast genome defined by RNA sequencing. Science 320(5881):1344-9
2003-09-22The start site of RRP8/YDR083W was moved 57 nt (19 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2006-01-19SGD confirmed the sequence error suggested by Kellis et al and has updated the sequence accordingly. As a consequence of this change, RRP8/YDR083W has been extended on the 3' end, altering the C-terminus and increasing the size of the predicted protein from 383 to 392 amino acids. 
Insert a G after the G at 613206

New: 613187 AAGACGGAAAATTGCCGAAGGAAAATGGCTCTTGAAGC 613224
            |||||||||||||||||||| |||||||||||||||||
Old: 613187 AAGACGGAAAATTGCCGAAG-AAAATGGCTCTTGAAGC 613223
Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54