SNF11/YDR073W Locus History Help


Nomenclature History
Standard Name Reference
SNF11 Treich I, et al.  (1995) SNF11, a new component of the yeast SNF-SWI complex that interacts with a conserved region of SNF2. Mol Cell Biol 15(8):4240-8
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs IPT1/YDR072C and SNF11/YDR073W.
New    592014   CAAGGATAACCCCGCTGTGCGGTGAAACCACCCTCTTTTCACGTTTCTTCAAGGCCAGTG  592073
                ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Old    592013   CAAGGATAACCCCGCTGTGCG-TGAAACCACCCTCTTTTCACGTTTCTTCAAGGCCAGTG  592071
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()