UBC5/YDR059C Locus History Help


Nomenclature History
Standard Name Reference
UBC5 Seufert W and Jentsch S  (1990) Ubiquitin-conjugating enzymes UBC4 and UBC5 mediate selective degradation of short-lived and abnormal proteins. EMBO J 9(2):543-50
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs UBC5/YDR059C and MAK21/YDR060W.
New    569985   ATGCTTCAAAAGCGCTTGCTACGAGAGTTTACACCGTACTAGCACTAGCAATACATCTAG  570044
                ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old    569984   ATGCTTCAAAA-CGCTTGCTACGAGAGTTTACACCGTACTAGCACTAGCAATACATCTAG  570042
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()