- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Expression
- Protein
- Wiki
| Sequence Annotation Notes | |
|---|---|
| Date | Note |
| 2006-04-13 | Due to the correction of a sequence error, the stop site of YDR015C was moved 150 nt upstream, making the predicted protein 79 amino acids rather than 129 aa. The old coordinates for YDR015C were 478195-477806, but are now 478196-477957. |
| Tsubouchi H and Roeder GS (2006) Budding yeast Hed1 down-regulates the mitotic recombination machinery when meiotic recombination is impaired. Genes Dev 20(13):1766-75 | |
| 2006-04-13 | A sequence error in the SGD sequence has been corrected: a single C was inserted in between the G at chromosomal coordinate 478023 and the C at 478024 on chromosome IV (what was three Cs is now 4 Cs). This makes the ORF of YDR015C shorter (79 amino acids) than what was originally annotated (129 aa).
New: 181 AAACAACAACTTCGTGCCAAAAATCTGTCTGAGAACACAGGTGGCGGAAGCCCCAATGGG 240
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Old: 477974 AAACAACAACTTCGTGCCAAAAATCTGTCTGAGAACACAGGTGGCGGAAG-CCCAATGGG 478032 |
| Tsubouchi H and Roeder GS (2006) Budding yeast Hed1 down-regulates the mitotic recombination machinery when meiotic recombination is impaired. Genes Dev 20(13):1766-75 | |




