- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Expression
- Protein
- Wiki
| Nomenclature History | |
|---|---|
| Standard Name | Reference |
| TRP1 | Campbell, D. (1989) Personal Communication, Mortimer Map Edition 10 |
| Sequence Annotation Notes | |
|---|---|
| Date | Note |
| 2004-02-11 | Although the systematic sequence for TRP1/YDR007W originally contained a nonsense (ochre) mutation at codon 67, systematic reference strain S288C does not actually contain this mutation in TRP1, which was introduced during the creation of strain AB972. AB972 is an ethidium bromide-induced derivative of the strain X2180-1B-trp1, which was supplied by E. Jones [M.V. Olson]. The lineage of AB972 traces directly to the strain S288C with no intervening outcrosses. The strain AB972 was the origin of the clone used for sequencing this segment of chromosome IV. In order to more accurately present this region of within the S288C reference strain, SGD has sequenced the S288C TRP1 locus and did not find the internal STOP codon. Thus, SGD has updated the TRP1 sequence by changing the previously annotated internal STOP (TAA) to serine (TCA). New: 462018 AAAGCATATAAAAATAGTTCAGGCACTCCGAAATACTTGGTTGGCGTGTTTCGTAATCAA 462077
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Old: 462018 AAAGCATATAAAAATAGTTAAGGCACTCCGAAATACTTGGTTGGCGTGTTTCGTAATCAA 462077 |
| Mapping Notes | |
|---|---|
| Date | Note |
| 1989-10-01 | Edition 10: trp1 to cen4 distance was determined from the segregation of this gene versus the segregation of a trisomic chromosome. This provides an absolute detrimination of the second division segregation frequency of trp1 (.0050). The observed low frequency justifies the use of trp1 to monitor first division segregation frequencies |
| Mortimer RK, et al. (1989) Genetic map of Saccharomyces cerevisiae, edition 10. Yeast 5(5):321-403 | |
| 1997-10-20 | Edition 14: The sequence of TRP1 contains an in-frame stop codon (an ochre mutation) at codon 67; this is the sequence of TRP1 in a derivative strain of S288C, which was used in the systematic sequencing of TRP1/YDR007W. |
| Cherry JM, et al. (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73 | |




