GYP7/YDL234C Locus History Help


Nomenclature History
Standard Name Reference
GYP7 Vollmer P, et al.  (1999) Primary structure and biochemical characterization of yeast GTPase-activating proteins with substrate preference for the transport GTPase Ypt7p. Eur J Biochem 260(1):284-90
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion was made in the intergenic region between ORFs YPD1/YDL235C and GYP7/YDL234C.
New    33961    TTCTTTTGAATTTTTCAAAGAAATAAAACTATTACACGTCAGTGGTT-ATCAATGATCCA  34019
                ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    33961    TTCTTTTGAATTTTTCAAAGAAATAAAACTATTACACGTCAGTGGTTTATCAATGATCCA  34020
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()