SEC31/YDL195W Locus History Help


Nomenclature History
Standard Name Reference
SEC31 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution within the coding region of SEC31/YDL195W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 367 is now Threonine rather than Serine.
New    108300   AAGCCAACTGTTTTCCATTTACAAGCCCCAACTTGGTATGGGGAACCATCTCCCGCAGCT  108359
                |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    108301   AAGCCATCTGTTTTCCATTTACAAGCCCCAACTTGGTATGGGGAACCATCTCCCGCAGCT  108360
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()