RPL41A/YDL184C Locus History 
- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Expression
- Protein
- Wiki
| Nomenclature History | |
|---|---|
| Standard Name | Reference |
| RPL41A | SGD (2007) Information without a citation in SGD () |
| Other Name(s) | Reference |
|---|---|
| L41A | Planta RJ and Mager WH (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7 |
| L41e | Jenner L, et al. (2012) Crystal structure of the 80S yeast ribosome. Curr Opin Struct Biol 22(6):759-67 |
| L47A | Planta RJ and Mager WH (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7 |
| YL41 | Planta RJ and Mager WH (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7 |
| Sequence Annotation Notes | |
|---|---|
| Date | Note |
| 2011-02-03 | A single nucleotide substitution was made in the intergenic region between ORFs RPL41A/YDL184C and YDL183C.
New 130620 TGGGGAAAAGTGAAACTTTCGGGTAGGGTAATGAGGCCAGCCTTGCCTGGGAAAAAGTTA 130679
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old 130621 TGGGGTAAAGTGAAACTTTCGGGTAGGGTAATGAGGCCAGCCTTGCCTGGGAAAAAGTTA 130680 |
| Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. () | |
| Mapping Notes | |
|---|---|
| Date | Note |
| 1997-10-20 | Edition 14: The name RPL41A was previously used to refer to YNL162W, which is now called RPL42A and encodes ribosomal protein L42A; RPL47A (RPL41A) and RPL47B (RPL41B) code for identical proteins |
| Cherry JM, et al. (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73 | |
