LYS20/YDL182W Locus History Help


Nomenclature History
Standard Name Reference
LYS20 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between ORFs YDL183C and LYS20/YDL182W.
New    132240   TTTTATGGGCTCTAAATCGGTATAAGCTCAACAAATGGTTGAGGGCCGAATAAACGAAAA  132299
                ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Old    132241   TTTTATGGGCTCTAAATCGGTATAAGCTCAACAAATGGTTGAGGGCCGAATTAACGAAAA  132300
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()