ARF2/YDL137W Locus History Help


Nomenclature History
Standard Name Reference
ARF2 Stearns T, et al.  (1990) ADP ribosylation factor is an essential protein in Saccharomyces cerevisiae and is encoded by two genes. Mol Cell Biol 10(12):6690-9
Sequence Annotation Notes
DateNote
2007-04-04ARF2/YDL137W mRNA contains an intron in the 5' untranslated region (UTR).

Miura F, et al.  (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
Juneau K, et al.  (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs RGT2/YDL138W and ARF2/YDL137W.
New    215950   CGATCTTGCACCTCCACGTACTCCTTTTGAATAGTACACATATACCCTTACAGGAGATCG  216009
                |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    215951   CGATCTTGCACCTCCACGTACTCCTTTTGAATAGTACACATATACC-TTACAGGAGATCG  216009
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1989-10-01Edition 10: arf1-cdc36-cdc9-arf2-cdc2 order established by three point crosses

Mortimer RK, et al.  (1989) Genetic map of Saccharomyces cerevisiae, edition 10. Yeast 5(5):321-403
1994-08-01Edition 12: pph21 and arf2 are adjacent genes

Mortimer RK, et al.  (1994) "Genetic and Physical maps of Saccharomyces cerevisiae (Edition 12)". Pp. 374-377 in 1994 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America