YDL071C Feature History Help


Nomenclature History
Other Name(s)Reference
IRC1 Alvaro D, et al.  (2007) Genome-wide analysis of Rad52 foci reveals diverse mechanisms impacting recombination. PLoS Genet 3(12):e228
Nomenclature History Notes
DateNote
2007-05-07IRC1 (Increased Recombination Centers) used to be the reserved name for YDL071C. This name was moved to be a retired name upon the author's request.
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion was made in the intergenic region between ORFs YET3/YDL072C and YDL071C.
New    330540   TTGCTATATACCATTGTTATATACGGCACTTTT-CCACTCTTCTTCCCCTTAATGGAGTG  330598
                ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old    330540   TTGCTATATACCATTGTTATATACGGCACTTTTTCCACTCTTCTTCCCCTTAATGGAGTG  330599
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()