CBS1/YDL069C Locus History Help


Nomenclature History
Standard Name Reference
CBS1 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2003-09-22The start site of CBS1/YDL069C was moved 12 nt (4 codons) downstream, based on automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Deletion analyses by Krause-Bucholz et al. 2000 demonstrate that N-terminal sequences are not essential for either the function or mitochondrial targeting of this protein.

Krause-Buchholz U, et al.  (2000) Identification of functionally important regions of the Saccharomyces cerevisiae mitochondrial translational activator Cbs1p. Yeast 16(4):353-63
Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs BDF2/YDL070W and CBS1/YDL069C.
New    332949   ATGGGCTTCATGCCCTAATTAAGGAAAAAAAGAAAAGAAAAAAAAAATTGGGAAGAATGG  333008
                |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    332950   ATGGGCTTCATGCCCTAATTAAGGAAAAAAAGAAAAGAAAAAAAAA-TTGGGAAGAATGG  333008
Dietrich F  (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. ()