SLM3/YDL033C Locus History Help


Nomenclature History
Standard Name Reference
SLM3 Audhya A, et al.  (2004) Genome-wide lethality screen identifies new PI4,5P2 effectors that regulate the actin cytoskeleton. EMBO J 23(19):3747-57
Other Name(s)Reference
MTO2 Yan Q, et al.  (2005) Mutations in MTO2 related to tRNA modification impair mitochondrial gene expression and protein synthesis in the presence of a paromomycin resistance mutation in mitochondrial 15 S rRNA. J Biol Chem 280(32):29151-7
MTU1 Umeda N, et al.  (2005) Mitochondria-specific RNA-modifying enzymes responsible for the biosynthesis of the wobble base in mitochondrial tRNAs. Implications for the molecular pathogenesis of human mitochondrial diseases. J Biol Chem 280(2):1613-24
Nomenclature History Notes
DateNote
2005-01-13MTO2 was a reserved name for YDL033C from May 2004 to January 2005 but was never published. The gene name reservation was removed when a different name, SLM3, was published for YDL033C (see Audhya et al., 2004).

Audhya A, et al.  (2004) Genome-wide lethality screen identifies new PI4,5P2 effectors that regulate the actin cytoskeleton. EMBO J 23(19):3747-57
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between ORFs YDL034W and SLM3/YDL033C.
New    392578   GGTTCAATTAGGCAAGTATGTTGCTAAGATTAATTGCTGCGGCGCATCGTATAAGGTGAT  392637
                |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old    392576   GGTTCAATTAGGCAAGTATGTTGCTAAGATTAATTGCTGCAGCGCATCGTATAAGGTGAT  392635
Dietrich F  (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. ()