SLM3/YDL033C Locus History 
- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Expression
- Protein
- Wiki
| Nomenclature History | |
|---|---|
| Standard Name | Reference |
| SLM3 | Audhya A, et al. (2004) Genome-wide lethality screen identifies new PI4,5P2 effectors that regulate the actin cytoskeleton. EMBO J 23(19):3747-57 |
| Other Name(s) | Reference |
|---|---|
| MTO2 | Yan Q, et al. (2005) Mutations in MTO2 related to tRNA modification impair mitochondrial gene expression and protein synthesis in the presence of a paromomycin resistance mutation in mitochondrial 15 S rRNA. J Biol Chem 280(32):29151-7 |
| MTU1 | Umeda N, et al. (2005) Mitochondria-specific RNA-modifying enzymes responsible for the biosynthesis of the wobble base in mitochondrial tRNAs. Implications for the molecular pathogenesis of human mitochondrial diseases. J Biol Chem 280(2):1613-24 |
| Nomenclature History Notes | |
|---|---|
| Date | Note |
| 2005-01-13 | MTO2 was a reserved name for YDL033C from May 2004 to January 2005 but was never published. The gene name reservation was removed when a different name, SLM3, was published for YDL033C (see Audhya et al., 2004). |
| Audhya A, et al. (2004) Genome-wide lethality screen identifies new PI4,5P2 effectors that regulate the actin cytoskeleton. EMBO J 23(19):3747-57 | |
| Sequence Annotation Notes | |
|---|---|
| Date | Note |
| 2011-02-03 | A single nucleotide substitution was made in the intergenic region between ORFs YDL034W and SLM3/YDL033C.
New 392578 GGTTCAATTAGGCAAGTATGTTGCTAAGATTAATTGCTGCGGCGCATCGTATAAGGTGAT 392637
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old 392576 GGTTCAATTAGGCAAGTATGTTGCTAAGATTAATTGCTGCAGCGCATCGTATAAGGTGAT 392635 |
| Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. () | |
