NHP6B/YBR089C-A Locus History Help


Nomenclature History
Standard Name Reference
NHP6B Kolodrubetz D and Burgum A  (1990) Duplicated NHP6 genes of Saccharomyces cerevisiae encode proteins homologous to bovine high mobility group protein 1. J Biol Chem 265(6):3234-9
Sequence Annotation Notes
DateNote
2000-08-11old name: YBR090C-A; new name: YBR089C-A; date: 11/1998; old coord: ChrII 426447 426148; SGDID: S0002157; Name changed due to nomenclature
2007-04-04NHP6B/YBR089C-A mRNA contains an intron in the 5' untranslated region (UTR).

Miura F, et al.  (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
Juneau K, et al.  (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
2011-02-03Nucleotide substitutions within the coding region of NHP6B/YBR089C-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 30 is now Glycine rather than Arginine.
New    426355  GACAATGTCTCTGTTTTCATTAGCAAAGAACATATAAGCTGACAAGCCCCTCTTAGGGGC  426414
               ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||
Old    426349  GACAATGTCTCTGTTTTCATTAGCAAAGAACATATAAGCTGACAACCGCCTCTTAGGGGC  426408
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()