PRE4/YFR050C Locus History Help


Nomenclature History
Standard Name Reference
PRE4 Hilt W, et al.  (1993) The PRE4 gene codes for a subunit of the yeast proteasome necessary for peptidylglutamyl-peptide-hydrolyzing activity. Mutations link the proteasome to stress- and ubiquitin-dependent proteolysis. J Biol Chem 268(5):3479-86
Sequence Annotation Notes
DateNote
2003-09-26A single G nucleotide was deleted from the intergenic region between ORFs YFR050C and YFR051C.
Old: 250051 TAAACTATATATATAGAAGGACGAAAGAAAAGGATACCTCGATTTTTATTTATTTAGTTT 250110
            |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
New: 250051 TAAACTATATATATAGAAGGACGAAAGAAAAG-ATACCTCGATTTTTATTTATTTAGTTT 250109
Robben J, et al.  (2002) Revisiting the yeast chromosome VI DNA sequence reveals a correction merging YFL007w and YFL006w to a single ORF. Yeast 19(8):699-702