YMR31/YFR049W Locus History Help


Nomenclature History
Standard Name Reference
YMR31 Matsushita Y, et al.  (1989) Cloning and analysis of the nuclear genes for two mitochondrial ribosomal proteins in yeast. Mol Gen Genet 219(1-2):119-24
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between ORFs RMD8/YFR048W and YMR31/YFR049W.
New    248159  CATTAAAAATAAATTAATGATATATTTAGTTATCAAGGTTTTTAGTCATATATTTCACCG  248218
               |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Old    248146  CATTAAAAATAAATAAATGATATATTTAGTTATCAAGGTTTTTAGTCATATATTTCACCG  248205
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()