DUG1/YFR044C Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2007-02-07.
Standard Name Reference
DUG1 Ganguli D, et al.  (2007) The Alternative Pathway of Glutathione Degradation Is Mediated by a Novel Protein Complex Involving Three New Genes in Saccharomyces cerevisiae. Genetics 175(3):1137-51
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made within the intergenic region between ORFs DUG1/YFR044C and YFR045W.
New    241559  GAATGACGAATATAAGGGATATTGCTAAAATATGCTGTGGCATTGGTCAACTTAAAAGAA  241618
               |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Old    241546  GAATGACGAATATAAGGGATATTGCTAAAAAATGCTGTGGCATTGGTCAACTTAAAAGAA  241605
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()