IRC5/YFR038W Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2008-03-03.
Standard Name Reference
IRC5 Alvaro D, et al.  (2007) Genome-wide analysis of Rad52 foci reveals diverse mechanisms impacting recombination. PLoS Genet 3(12):e228
Sequence Annotation Notes
DateNote
2004-02-05Based on the automated comparison of related fungi, Kellis et al. and Brachat et al. suggested that the stop site for YFR038W be moved 226 nt downstream. Hui-fen Kuo and Eric Richards resequenced this portion of the genome and found that a G nt. should be deleted (personal communication to SGD). This sequence error was confirmed by SGD. As a consequence of this sequence change, YFR038W was extended 226 nt at the 3' end, altering the the C-terminus and increasing the size of the predicted protein from 778 to 853 amino acids.
New: 231648 AAAAATTGGCGTTAAATGAAGG-TTCTTTTTTGAAGGCAAA 231687 
            |||||||||||||||||||||| ||||||||||||||||||
Old: 231648 AAAAATTGGCGTTAAATGAAGGGTTCTTTTTTGAAGGCAAA 231688
Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Brachat S, et al.  (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45