FAB1/YFR019W Locus History Help


Nomenclature History
Standard Name Reference
FAB1 Yamamoto A, et al.  (1995) Novel PI(4)P 5-kinase homologue, Fab1p, essential for normal vacuole function and morphology in yeast. Mol Biol Cell 6(5):525-39
Other Name(s)Reference
SVL7 Zheng B, et al.  (1998) Isolation of yeast mutants defective for localization of vacuolar vital dyes. Proc Natl Acad Sci U S A 95(20):11721-6
Sequence Annotation Notes
DateNote
2011-02-03Nucleotide change(s) in the coding region of FAB1/YFR019W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 2275 is now Arginine rather than Tryptophan.
New    191280  AAGCAATGGAGAGGTATATTTTGATGGTTCCTGATCCGTGGTATAGGGAAGGAAATTAAT  191339
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    191268  AAGCAATGGAGAGGTATATTTTGATGGTTCCTGATCCGTGGTATTGGGAAGGAAATTAAT  191327
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03A single nucleotide substitution was made within the intergenic region between ORF FAB1/YFR019W and tRNA tS(GCU)F.
New    191390  CGCACATTAGTGTTCTTTAACTTTCAGTACCTTAGTAGTTATCAACTATGAAAAGGTGGT  191449
               |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Old    191378  CGCACATTAGGGTTCTTTAACTTTCAGTACCTTAGTAGTTATCAACTATGAAAAGGTGGT  191437
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()