BLM10/YFL007W Locus History 
- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Expression
- Protein
- Wiki
| Nomenclature History | |
|---|---|
| Standard Name | Reference |
| BLM10 | Doherty K, et al. (2004) Expression of the expanded YFL007w ORF and assignment of the gene name BLM10. Yeast 21(12):1021-3 |
| Nomenclature History Notes | |
|---|---|
| Date | Note |
| 2005-09-27 | The name BLM3, originally referring to a genetic locus, has also been associated with YFL007W (now called BLM10) due to an error in cloning. It was later determined that blm3-1 is an allele of UBP3/YER151C. |
| Doherty K, et al. (2004) Expression of the expanded YFL007w ORF and assignment of the gene name BLM10. Yeast 21(12):1021-3 | |
| McCullock S, et al. (2006) blm3-1 Is an Allele of UBP3, a Ubiquitin Protease that Appears to Act During Transcription of Damaged DNA. J Mol Biol 363(3):660-72 | |
| Sequence Annotation Notes | |
|---|---|
| Date | Note |
| 2003-09-26 | Due to the insertion of a G at 128870 on Chromosome VI, YFL006W has been merged with BLM10/YFL007W. YFL006W is now an alias of BLM10/YFL007W. Personal communication from Tim Formosa, University of Utah.
Old: 128841 TTTGATCACCCATACGATCAGGTTCGCCAG-CTGTCGCTAAACTATTGACGACCTTAGTT 128899
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New: 128841 TTTGATCACCCATACGATCAGGTTCGCCAGGCTGTCGCTAAACTATTGACGACCTTAGTT 128900 |
| Robben J, et al. (2002) Revisiting the yeast chromosome VI DNA sequence reveals a correction merging YFL007w and YFL006w to a single ORF. Yeast 19(8):699-702 | |
| Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | |
