CDC4/YFL009W Locus History Help


Nomenclature History
Standard Name Reference
CDC4 Hartwell LH  (1971) Genetic control of the cell division cycle in yeast. II. Genes controlling DNA replication and its initiation. J Mol Biol 59(1):183-94
Sequence Annotation Notes
DateNote
2011-02-03Several nucleotides were changed in the intergenic region between ORF CDC4/YFL009W and ARS603.5.
New    118571  ACTTCGTACATTTTATTGAATATAAACTGCAGCTAAACTGCTTGTATGT-TCAATTTTAA  118629
               ||||||||||||||||||| ||||||||||||||||||||| || |||| ||||||||||
Old    118565  ACTTCGTACATTTTATTGAGTATAAACTGCAGCTAAACTGCCTGGATGTGTCAATTTTAA  118624
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()