HAC1/YFL031W Locus History 
- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Expression
- Protein
- Wiki
| Nomenclature History | |
|---|---|
| Standard Name | Reference |
| HAC1 | Mori K, et al. (1996) Signalling from endoplasmic reticulum to nucleus: transcription factor with a basic-leucine zipper motif is required for the unfolded protein-response pathway. Genes Cells 1(9):803-17 |
| Other Name(s) | Reference |
|---|---|
| ERN4 | Mori K, et al. (1996) Signalling from endoplasmic reticulum to nucleus: transcription factor with a basic-leucine zipper motif is required for the unfolded protein-response pathway. Genes Cells 1(9):803-17 |
| IRE15 | Nikawa J, et al. (1997) Suppression of the Saccharomyces cerevisiae hac1/ire15 mutation by yeast genes and human cDNAs. Gene 201(1-2):5-10 |
| Sequence Annotation Notes | |
|---|---|
| Date | Note |
| 2003-12-02 | Based on comparison with related fungi, Kellis et al. propose that YFL032W and YFL031W be merged into a single, larger ORF. SGD has re-sequenced this segment of the chromosome, in S288C, and confirmed the presence of an in-frame stop codon between these two ORFs. Although it is possible that these ORFs are merged in other strains of S. cerevisiae, the systematic sequence will not be changed. |
| Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | |
| 2001-05-29 | A single C was inserted after the C at chromosomal coordinate 75751 (see GenBank file YSCCHRVIN). In addition, a new intron was annotated at relative coordinates 662-913. As a result, the chromosomal coordinates for ORF YFL031W are now 75177-75837..76090-76145, with relative coordinates 1-661..914-969. The old chromosomal coordinates for YFL031W were 75178-75780, with old relative coordinates 1-603.
Old: 75721 AACAACAATTTGTTTGATGCGGTGGCCTCGC-GTTGGCAGACCCACTCTGCGACGATATA 75779
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
New: 75720 AACAACAATTTGTTTGATGCGGTGGCCTCGCCGTTGGCAGACCCACTCTGCGACGATATA 75779 |
